Not really. Delivering gene edits via CRISPR in this way is more like editing a ... | Hacker News

Hacker Newsnew | past | comments | ask | show | jobs | submit

		fwip 3 months ago \| parent \| context \| favorite \| on: Baby is healed with first personalized gene-editin... Not really. Delivering gene edits via CRISPR in this way is more like editing a text file with a single application of a regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.

xarope 3 months ago | [–]

TIL my years of perl regex'ing was preparing me for a future of DNA gene warfare

(core war, anybody?)

duskwuff 3 months ago | | [–]

I don't know if it still is, but, for a while, Perl was actually fairly popular in bioinformatics: https://bioperl.org/

anthk 3 months ago | [–]

So, Perl or sed. If it's Perl, the guy from XKCD was right. And, maybe, Larry Wall.

Guidelines | FAQ | Lists | API | Security | Legal | Apply to YC | Contact